Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV mouse Dscam-like
(Plasmid #18738)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 18738 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV script
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4300
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    DscamL
  • Alt name
    dscam like
  • Species
    M. musculus (mouse)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A fragment of mouse Dscam-like-1 cDNA was amplified from the mKIAA1132 plasmid (Kazusa DNA Research Institute) using the following primers: GGCCGCGGCCGCCCGCACGGCCGGCCACAGGACCACC and CGCGGTCGACAGGTCCCAGTGTGGAGCCCTTCTCC. This fragment was cloned into the NotI/SalI sites of pCMVscript. To complete its open reading frame, a BglII fragment of this plasmid was replaced by a cDNA amplified from mouse brain using the following primers: GGCCAGATCTCCGCACGGCCGGCCACAGGACCACC and CGCGAGATCTGTTGCCGTTGTGCTTGAGGGAGAC.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV mouse Dscam-like was a gift from Joshua Sanes (Addgene plasmid # 18738 ; http://n2t.net/addgene:18738 ; RRID:Addgene_18738)
  • For your References section:

    Dscam and Sidekick proteins direct lamina-specific synaptic connections in vertebrate retina. Yamagata M, Sanes JR. Nature. 2008 Jan 24. 451(7177):465-9. 10.1038/nature06469 PubMed 18216854