pCJR01
(Plasmid #187888)

• Purpose: Escherichia coli plasmid with cloned regions of homology to Campylobacter jejuni chromosome flanking a NotI restriction site. pCJR01 functions as a suicide vector for integrating cloned NotI DNA.
• Depositing Lab: Gaylen Uhlich
• Publication: Uhlich et al Biotechniques. 2022 Apr 13. doi: 10.2144/btn-2021-0096.

Backbone

• Vector backbone: pBC SK+
• Backbone manufacturer: Stratagene (Agilent Tech)
• Backbone size w/o insert (bp): 3334
• Total vector size (bp): 5338
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DNA insert has homology to a rRNA region of the Campylobacter jejuni chromosome with an added central NotI restriction site
• Species: Campylobacter jejuni strain CDC9511
• Insert Size (bp): 2004
• Promoter: none

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgggccccccctcgacgcgtaggcggattatcaagtc
• 3′ sequencing primer: accgcggtggcggcctcgccgctactgacgcaatctc

Resource Information

• Supplemental Documents:
  • pCJR01 map.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry