pGB-06-07-Vps34
(Plasmid
#187989)
-
PurposePlasmid for the protein expression of Vps34 in a bacterial and insect expression system. Internal_Reference: SMC1323
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187989 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGB-06-07
- Backbone size w/o insert (bp) 2935
- Total vector size (bp) 5599
-
Vector typeBacterial Expression, Insect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVps34
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2664
-
GenBank ID5289 NM_002647
-
Entrez GenePIK3C3 (a.k.a. VPS34, Vps34, hVps34)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cCcggtccgaaaccATGGGCGAAGCGGAGAAAT
- 3′ sequencing primer TCCCCAGAACATCAGGTTAATGGCGTTATTTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGB-06-07-Vps34 was a gift from Sascha Martens (Addgene plasmid # 187989 ; http://n2t.net/addgene:187989 ; RRID:Addgene_187989)