Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Yeast_Target-AID3S
(Plasmid #188646)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 188646 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS415
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nCas9-AID2S-UGI
  • Species
    Synthetic; Streptococcus pyogenes
  • Insert Size (bp)
    4791
  • Mutation
    D10A for SpCas9
  • GenBank ID
    OYN72315.1 ABO15149.1
  • Promoter pGal1
  • Tag / Fusion Protein
    • UGI

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer caacaaaaaattgttaatatacctc
  • 3′ sequencing primer AGGTTTTCAGTATAATGTTACATGC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Yeast_Target-AID3S was a gift from Keiji Nishida (Addgene plasmid # 188646 ; http://n2t.net/addgene:188646 ; RRID:Addgene_188646)

  • For your References section:

    Cytosine base editing systems with minimized off-target effect and molecular size. Li A, Mitsunobu H, Yoshioka S, Suzuki T, Kondo A, Nishida K. Nat Commun. 2022 Aug 8;13(1):4531. doi: 10.1038/s41467-022-32157-8. 10.1038/s41467-022-32157-8 PubMed 35941130
Related items: