pLenti-ALDH1A3gRNA3
(Plasmid
#189748)
-
PurposeThe construct was used for expression of gRNA for knocking out of the ALDH1A3 gene in Cas9 expressing cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 189748 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti-v1
- Total vector size (bp) 8324
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameALDH1A3 gRNA
-
gRNA/shRNA sequencetgaacttgacctccaggttg
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBl (unknown if destroyed)
- 3′ cloning site BsmBl (unknown if destroyed)
- 5′ sequencing primer N/A
- 3′ sequencing primer N/A (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-ALDH1A3gRNA3 was a gift from Robert Sobol (Addgene plasmid # 189748 ; http://n2t.net/addgene:189748 ; RRID:Addgene_189748) -
For your References section:
A specific inhibitor of ALDH1A3 regulates retinoic acid biosynthesis in glioma stem cells. Li J, Garavaglia S, Ye Z, Moretti A, Belyaeva OV, Beiser A, Ibrahim M, Wilk A, McClellan S, Klyuyeva AV, Goggans KR, Kedishvili NY, Salter EA, Wierzbicki A, Migaud ME, Mullett SJ, Yates NA, Camacho CJ, Rizzi M, Sobol RW. Commun Biol. 2021 Dec 21;4(1):1420. doi: 10.1038/s42003-021-02949-7. 10.1038/s42003-021-02949-7 PubMed 34934174