pD2529-CAG-b3
(Plasmid
#189797)
-
PurposeExpression of full length human integrin beta 3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 189797 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepD2529CAG
-
Backbone manufacturerAtum
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameintegrin b3
-
Alt namebeta 3 BDPLT16, BDPLT2, BDPLT24, CD61, GP3A, GPIIIa, GT, GT2
-
SpeciesH. sapiens (human)
-
Entrez GeneITGB3 (a.k.a. BDPLT16, BDPLT2, BDPLT24, CD61, GP3A, GPIIIa, GT, GT2)
-
Tag
/ Fusion Protein
- -P2A-mCherry (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTCCTACAGCTCCTGGGCAAC
- 3′ sequencing primer CATGTGCACCTTGAAGCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pD2529-CAG-b3 was a gift from Timothy Springer (Addgene plasmid # 189797 ; http://n2t.net/addgene:189797 ; RRID:Addgene_189797) -
For your References section:
A general chemical principle for creating closure-stabilizing integrin inhibitors. Lin FY, Li J, Xie Y, Zhu J, Huong Nguyen TT, Zhang Y, Zhu J, Springer TA. Cell. 2022 Sep 15;185(19):3533-3550.e27. doi: 10.1016/j.cell.2022.08.008. 10.1016/j.cell.2022.08.008 PubMed 36113427