pCAGGS SARS-CoV-2 BA.2.75 Spike
(Plasmid
#190012)
-
PurposeExpresses codon-optimized full length SARS-CoV-2 BA.2.75 Spike
-
Depositing Lab
-
Depositing OrganizationUniversity of Ottawa
Located in Canada -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190012 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4717
- Total vector size (bp) 8530
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 BA.2.75 Spike
-
Alt nameSARS CoV-2 Omicron BA.2.75 S
-
Insert Size (bp)3813
-
MutationContains the BA.2 mutations (T19I, LPPA24S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) with a R493Q reversion and K147E, W152R, F157L, I210V, G257S, D339R (mutated from G339D), G446S, and N460K mutations.
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter chicken β-actin promoter, CMV enhancer
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CTCTAGAGCCTCTGCTAACCATGTTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS SARS-CoV-2 BA.2.75 Spike was a gift from Marceline Côté (Addgene plasmid # 190012 ; http://n2t.net/addgene:190012 ; RRID:Addgene_190012) -
For your References section:
Spike recognition and neutralization of SARS-CoV-2 Omicron subvariants elicited after the third dose of mRNA vaccine. Tauzin A, Nicolas A, Ding S, Benlarbi M, Medjahed H, Chatterjee D, Dionne K, Gong SY, Gendron-Lepage G, Bo Y, Perreault J, Goyette G, Gokool L, Arlotto P, Morrisseau C, Tremblay C, Martel-Laferriere V, De Serres G, Levade I, Kaufmann DE, Cote M, Bazin R, Finzi A. Cell Rep. 2023 Jan 31;42(1):111998. doi: 10.1016/j.celrep.2023.111998. Epub 2023 Jan 9. 10.1016/j.celrep.2023.111998 PubMed 36656710