FLAG-dCas13b-ADAR2DD
(Plasmid
#190913)
-
PurposeAddgene #103871 with 3x FLAG on N-terminal of dCas13
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190913 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepC0055-CMV-dPspCas13b-GS-ADAR2DD(E488Q/T375G)-delta-984-1090
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 9525
- Total vector size (bp) 9646
-
Modifications to backboneAdded 3x FLAG label
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3X FLAG
-
SpeciesSynthetic
-
Insert Size (bp)211
- Promoter CMV
-
Tag
/ Fusion Protein
- 3X FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer gaggtctatataagcagagctctctgg
- 3′ sequencing primer gtatcaaacttaagcttgccaccatgaac (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene #114196
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FLAG-dCas13b-ADAR2DD was a gift from Timothy Jarome (Addgene plasmid # 190913 ; http://n2t.net/addgene:190913 ; RRID:Addgene_190913) -
For your References section:
Proteasome-independent K63 polyubiquitination selectively regulates ATP levels and proteasome activity during fear memory formation in the female amygdala. Farrell K, Musaus M, Auerbach A, Navabpour S, Ray WK, Helm RF, Jarome TJ. Mol Psychiatry. 2023 May 17. doi: 10.1038/s41380-023-02112-0. 10.1038/s41380-023-02112-0 PubMed 37198264