pVM62
(Plasmid
#191419)
-
PurposemRuby2 expression under TetR-Ptet promoter for characterization in mesophiles
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191419 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneBBR1-GmR-pAMβ1-EryR
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemRuby2
-
GenBank IDAFR60232.1
- Promoter TetR-Ptet
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TATTTCGATGCCCTGGACTT
- 3′ sequencing primer ccgagcgttctgaacaaatc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVM62 was a gift from Sheila Jensen (Addgene plasmid # 191419)