pProUSER63H0G-mRuby2
(Plasmid
#191421)
-
PurposemRuby2 expression under TetR-Ptet* promoter for characterization in mesophiles
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191421 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepProUSER63H0G
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsContains both Gentamycin & Kanamycin resistance casettes
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemRuby2
-
GenBank IDAFR60232.1
- Promoter TetR-Ptet*
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TATTTCGATGCCCTGGACTT
- 3′ sequencing primer ccgagcgttctgaacaaatc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pProUSER63H0G-mRuby2 was a gift from Sheila Jensen (Addgene plasmid # 191421)