pDEST_5xUAS:EB3-mScarlet-I
(Plasmid
#192358)
-
PurposeEB3 tagged with mScarlet-I, expressed under the UAS promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192358 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneGateway Tol2 destination vector with zebrafish aA-crystallin promoter driving CFP in lens
- Total vector size (bp) 8129
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEB3
-
Alt nameMAPRE3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)843
-
GenBank ID22924
-
Tag
/ Fusion Protein
- mScarlet-I (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gtctgaaacacaggccagat
- 3′ sequencing primer CCACATTTGTAGAGGTTTTACTTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe EB3 cDNA was given by the Gilmour lab (Revenu et al. 2014), but was originally cloned by Stepanova et al. 2003.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit for https://www.biorxiv.org/content/10.1101/2022.08.12.503784v1 bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDEST_5xUAS:EB3-mScarlet-I was a gift from Francesca Peri (Addgene plasmid # 192358 ; http://n2t.net/addgene:192358 ; RRID:Addgene_192358) -
For your References section:
A role for the centrosome in regulating the rate of neuronal efferocytosis by microglia in vivo. Moller K, Brambach M, Villani A, Gallo E, Gilmour D, Peri F. Elife. 2022 Nov 18;11:e82094. doi: 10.7554/eLife.82094. 10.7554/eLife.82094 PubMed 36398880