pAAV-ADP-MCS-FLAG
(Plasmid
#192360)
-
Purpose(Empty Backbone) Adipocyte-specific overexpression of genes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192360 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV
- Backbone size (bp) 4028
-
Modifications to backboneAdiponectin promoter-MCS-3xFlag
-
Vector typeMammalian Expression, AAV
- Promoter adiponectin promoter
-
Tag
/ Fusion Protein
- 3xflag (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ttgctctctgcagcagtgtg
- 3′ sequencing primer agcagcgtatccacatagcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-ADP-MCS-FLAG was a gift from Yifu Qiu (Addgene plasmid # 192360 ; http://n2t.net/addgene:192360 ; RRID:Addgene_192360) -
For your References section:
The mitochondrial calcium uniporter engages UCP1 to form a thermoporter that promotes thermogenesis. Xue K, Wu D, Wang Y, Zhao Y, Shen H, Yao J, Huang X, Li X, Zhou Z, Wang Z, Qiu Y. Cell Metab. 2022 Sep 6;34(9):1325-1341.e6. doi: 10.1016/j.cmet.2022.07.011. Epub 2022 Aug 16. 10.1016/j.cmet.2022.07.011 PubMed 35977541