ph7SK-CDX2-gRNA
(Plasmid
#192513)
-
PurposeContains gRNA for CDX2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192513 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneph7SK-gRNA
- Total vector size (bp) 3507
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCDX2
-
gRNA/shRNA sequenceGTACACGGACCACCAGCGGC
-
SpeciesH. sapiens (human)
-
Entrez GeneCDX2 (a.k.a. CDX-3, CDX2/AS, CDX3)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ph7SK-CDX2-gRNA was a gift from Mark Denham (Addgene plasmid # 192513 ; http://n2t.net/addgene:192513 ; RRID:Addgene_192513) -
For your References section:
Enhanced production of mesencephalic dopaminergic neurons from lineage-restricted human undifferentiated stem cells. Maimaitili M, Chen M, Febbraro F, Ucuncu E, Kelly R, Niclis JC, Christiansen JR, Mermet-Joret N, Niculescu D, Lauritsen J, Iannielli A, Klaestrup IH, Jensen UB, Qvist P, Nabavi S, Broccoli V, Nykjaer A, Romero-Ramos M, Denham M. Nat Commun. 2023 Dec 5;14(1):7871. doi: 10.1038/s41467-023-43471-0. 10.1038/s41467-023-43471-0 PubMed 38052784