Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLN-AIDA-Tyr1
(Plasmid #192831)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 192831 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLN4
  • Backbone manufacturer
    Anton Kan
  • Backbone size w/o insert (bp) 5198
  • Total vector size (bp) 7841
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    AIDA-Tyr1
  • Alt name
    AIDA fused to Tyrosinase 1
  • Species
    Synthetic; Bacillus megaterium
  • Insert Size (bp)
    2649
  • Promoter pL-lac

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGTGAACGCTCTCTACTAGAGTCAC
  • 3′ sequencing primer GCCTCTTTTCTGGAATTTGGTACCGAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The AIDA gene was originally obtained from pAIDA (Addgene plasmid #79180)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLN-AIDA-Tyr1 was a gift from André Studart (Addgene plasmid # 192831 ; http://n2t.net/addgene:192831 ; RRID:Addgene_192831)
  • For your References section:

    Complex Living Materials made by Light-based Printing of Genetically Programmed Bacteria. Binelli MR, Kan A, Rozas LEA, Pisaturo G, Prakash N, Studart AR. Adv Mater. 2022 Nov 29:e2207483. doi: 10.1002/adma.202207483. 10.1002/adma.202207483 PubMed 36444840