pLV-hCdt1(1-100)ΔCy-mCherry-P2A-mVenus-hGeminin(1-110)-IRES-Blast
(Plasmid #193139)

• Purpose: Expresses bicistronic P2A construct of C-CRL4Cdt2 reporter(hCdt1(1-100)ΔCy-mCherry-) and APC/C reporter (hGeminin(1-110)) with blasticidin resistance
• Depositing Lab: Tobias Meyer
• Publication: Ratnayeke et al Mol Cell. 2023 Jan 5;83(1):26-42.e13. doi: 10.1016/j.molcel.2022.12.004.

Backbone

• Vector backbone: pLV-EF1a-IRES-Blast
• Backbone size w/o insert (bp): 8576
• Vector type: Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hCdt1(1-100)ΔCy-mCherry-P2A-mVenus-hGeminin(1-110)
• Alt name: C-CRL4Cdt2 reporter and APC/C reporter
• Species: H. sapiens (human)
• Insert Size (bp): 2190
• Mutation: human Cdt1 amino acids 1-100 w/ ΔCy mutation (aa68-70 to alanine), human Geminin amino acids 1-110
• Entrez Gene: CDT1 (a.k.a. DUP, RIS2)
• Entrez Gene: GMNN (a.k.a. Gem, MGORS6)
• Promoter: EF1a

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tcaagcctcagacagtggttc
• 3′ sequencing primer: acaccggccttattccaa

Resource Information

• Supplemental Documents:
  • pLV-hCdt1(1-100)ΔCy-mCherry-P2A-mVenus-hGeminin(1-110)-IRES-Blast.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The 3rd generation packaging system (pMDLg/pRRE, pRSV-rev, and pVSVG) was used to create virus from this lentiviral transfer vector.