H1.224.luc
(Plasmid
#193704)
-
PurposeExpresses a truncated PolII H1 promoter (H1.244)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 193704 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3-Basic
-
Backbone manufacturerpromega
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTruncated PolIII H1 promoter of 224 nucleotides (H1.224) + N41 fragment
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer CTAGCAAAATAGGCTGTCCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
H1.224.luc was a gift from Elena Herrera-Carrillo (Addgene plasmid # 193704 ; http://n2t.net/addgene:193704 ; RRID:Addgene_193704) -
For your References section:
Engineered mini H1 promoters with dedicated RNA Polymerase II or III activity. Gao Z, van der Velden YU, Fan M, van der Linden CA, Vink M, Herrera-Carrillo E, Berkhout B. J Biol Chem. 2020 Nov 5. pii: S0021-9258(20)00012-5. doi: 10.1074/jbc.RA120.015386. 10.1074/jbc.RA120.015386 PubMed 33154168