Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Sniper2P
(Plasmid #193857)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 193857 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFUGW
  • Total vector size (bp) 12859
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sniper2L
  • Alt name
    Sniper2L
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4641
  • Mutation
    E1007L
  • Promoter EFS
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • FLAG (C terminal on insert)
    • BSD (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer 5' - ggtcttgaaaggagtgggaattgg - 3'
  • 3′ sequencing primer 5' - CAGGTCGCTTGTCGCCTCC - 3'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Sniper2P was a gift from Hyongbum Kim (Addgene plasmid # 193857 ; http://n2t.net/addgene:193857 ; RRID:Addgene_193857)
  • For your References section:

    Sniper2L is a high-fidelity Cas9 variant with high activity. Kim YH, Kim N, Okafor I, Choi S, Min S, Lee J, Bae SM, Choi K, Choi J, Harihar V, Kim Y, Kim JS, Kleinstiver BP, Lee JK, Ha T, Kim HH. Nat Chem Biol. 2023 Mar 9. doi: 10.1038/s41589-023-01279-5. 10.1038/s41589-023-01279-5 PubMed 36894722