pAS156
(Plasmid
#194479)
-
PurposesynER Part (Part 3)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194479 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepYKT001
- Backbone size w/o insert (bp) 1658
- Total vector size (bp) 3142
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesynER (Part 3)
-
SpeciesSynthetic
-
Insert Size (bp)1484
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GAGCCTATGGAAAAACGCCA
- 3′ sequencing primer ATTTGCCCATGGTGAAAACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAS156 was a gift from Ahmad Khalil (Addgene plasmid # 194479 ; http://n2t.net/addgene:194479 ; RRID:Addgene_194479) -
For your References section:
A Toolkit for Precise, Multigene Control in Saccharomyces cerevisiae. Sanford A, Kiriakov S, Khalil AS. ACS Synth Biol. 2022 Nov 11. doi: 10.1021/acssynbio.2c00423. 10.1021/acssynbio.2c00423 PubMed 36367334