Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUb FLAG-Mts
(Plasmid #195065)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 195065 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUb 3xFLAG MCS
  • Total vector size (bp) 5753
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    microtubule star
  • Species
    D. melanogaster (fly)
  • Entrez Gene
    mts (a.k.a. Dmel_CG7109, 5559, CG7109, DmPp2A-28D, Dmel\CG7109, ER2-6, MTS, MTS/PP2A, Mts, PP2, PP2A, PP2A 28D, PP2A C, PP2A-C, PP2A/MTS, PP2AC, PP2A[C], PP2A[[C]], PP2Ac, PP2a, PP2a 28D, Pp2A, Pp2A-28D, dPP2A, dPP2A-C, l(2)02496, l(2)s5286, pp2A)
  • Promoter Ubi-p63e
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CAAAGTTGGCGTCGATAAATAAGTTTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUb FLAG-Mts was a gift from Jeremy Wilusz (Addgene plasmid # 195065 ; http://n2t.net/addgene:195065 ; RRID:Addgene_195065)
  • For your References section:

    IntS6 and the Integrator phosphatase module tune the efficiency of select premature transcription termination events. Fujiwara R, Zhai SN, Liang D, Shah AP, Tracey M, Ma XK, Fields CJ, Mendoza-Figueroa MS, Meline MC, Tatomer DC, Yang L, Wilusz JE. Mol Cell. 2023 Nov 14:S1097-2765(23)00902-4. doi: 10.1016/j.molcel.2023.10.035. 10.1016/j.molcel.2023.10.035 PubMed 37995689