pRSET.HaloTag.v7.CoOp.Cys-less
(Plasmid
#195487)
-
PurposeBacterial expression plasmid with HaloTag v7 insert; modified to replace cysteines C61, C262, and optimized to human codon bias/preference for use in oxidizing environments.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195487 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRSET
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2863
- Total vector size (bp) 3763
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHaloTag.v7
-
Insert Size (bp)900
-
MutationC61T, C262V
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHIS (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Made at the request of and in collaboration with Erik L. Snapp using human codon bias/preference of highly expressed genes as reported by Haas et al. (1996). For use in oxidizing environments, such as the eukaryotic secretory pathway or bacterial periplasmic space.
Haas, J., Park, E. C., & Seed, B. (1996). Codon usage limitation in the expression of HIV-1 envelope glycoprotein. Current biology : CB, 6(3), 315–324. https://doi.org/10.1016/s0960-9822(02)00482-7
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSET.HaloTag.v7.CoOp.Cys-less was a gift from Tim Brown & HHMI-JRC Tool Translation Team (Addgene plasmid # 195487 ; http://n2t.net/addgene:195487 ; RRID:Addgene_195487)