2X_pX458_pSpCas9(BB)-2A-GFP_eSOX17.2_KO
(Plasmid
#195495)
-
PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the core endoderm distal enhancer of human SOX17
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195495 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbone2X_pX458_pSpCas9(BB)-2A-GFP (Plasmid #172221)
-
Backbone manufacturerAlexander Meissner
- Backbone size w/o insert (bp) 9699
- Total vector size (bp) 9703
-
Modifications to backboneTwo sgRNAs targeting the core endoderm distal enhancer of SOX17
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA
-
gRNA/shRNA sequenceGATTAGGTGGCCCCTAACAC, CAAAATCCATGCTAGGCTCC
-
SpeciesH. sapiens (human)
-
GenBank IDhg19, chr8:55137540-55138209
-
Entrez GeneSOX17 (a.k.a. VUR3)
- Promoter U6
-
Tags
/ Fusion Proteins
- 3XFLAG (N terminal on insert)
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGATACAAGGCTGTTAGAGAG
- 3′ sequencing primer ggaaagtccctattggcgtta (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bysgRNAs were ordered from Sigma-Aldrich as synthetic ssODN oligonucleotides
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
2X_pX458_pSpCas9(BB)-2A-GFP_eSOX17.2_KO was a gift from Alexander Meissner (Addgene plasmid # 195495 ; http://n2t.net/addgene:195495 ; RRID:Addgene_195495) -
For your References section:
T-REX17 is a transiently expressed non-coding RNA essential for human endoderm formation. Landshammer A, Bolondi A, Kretzmer H, Much C, Buschow R, Rose A, Wu HJ, Mackowiak SD, Braendl B, Giesselmann P, Tornisiello R, Parsi KM, Huey J, Mielke T, Meierhofer D, Maehr R, Hnisz D, Michor F, Rinn JL, Meissner A. Elife. 2023 Jan 31;12:e83077. doi: 10.7554/eLife.83077. 10.7554/eLife.83077 PubMed 36719724