1
Plasmid 19820: pCAG-EGFP/RFP-miR-E2-4int
  • miRNA

  • 400

  • pCAG-EGFP/RFP-int
    (Search Vector Database)

  • Mammalian Expression, RNAi, Cre/Lox

  • 8200

  • AsiSI

  • No

  • MluI

  • No

  • GCTGGACATCACCTCCCACAACG List of Sequencing Primers

  • ACAGGAGGTGGGGAGCAGGAGA

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (1)
  • Zuoshang Xu

  • MTA
    Clontech Limited Use Label License

Comments: 

A fragment of ~400 bases surrounding the miRNA insertion site was amplified from the first intron of the vector pUbC-miRNA-EGFP [36] with primers 5'-GCAATGACGCGATCGCTAATGCGGGAAAGCTCTTATTCGGGT-3' (forward) and 5'-AAGGCATGACGCGTTGTTGCGGCCGCCAGAGGTCCGGCGCCTGT-3' (reverse).

miR-E2-4:
GGTACCTGCTGTTGACAGTGAGCGAGAAGTGGTGTATCTAGAGATTATAGTGAAGCCACAGATGTATAATCTCTATACACCACTTCCTGCCTACTGCCTCGGACTTCAAGGGGAATTC

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A construct with fluorescent indicators for conditional expression of miRNA. Qiu et al (BMC Biotechnol. 2008 . 8():77. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 19820" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only