pBUE411-B
(Plasmid
#198234)
-
PurposepPLTP::BBM cassette in pBUE411
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198234 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBUE411
- Backbone size w/o insert (bp) 6500
- Total vector size (bp) 18709
-
Vector typePlant Expression, CRISPR ; plant binary vector
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepPLTP::BBM cassette
-
SpeciesZea mays; Agrobacterium tumefaciens
-
Insert Size (bp)3582
- Promoter PLTP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AflII (destroyed during cloning)
- 3′ cloning site AflII (not destroyed)
- 5′ sequencing primer GCGCCACGCTGCTACTGCTGCTAC
- 3′ sequencing primer ttctgcaggCGCGCTAATTCCCGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.09.02.506370v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBUE411-B was a gift from Andrea Gallavotti (Addgene plasmid # 198234 ; http://n2t.net/addgene:198234 ; RRID:Addgene_198234)