pHD57 [Tol2-UAS:sypb-egfp-cry2-polyA]
(Plasmid
#198381)
-
PurposeExpression of SYPB::CRY2olig(535) in neurons of Danio rerio
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198381 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDestTol2CG
- Backbone size w/o insert (bp) 5883
- Total vector size (bp) 10209
-
Vector typeTol2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUAS:sypb-egfp-cry2
-
Alt nameSypb-EGFP-Cry2(D387A)olig(535)
-
SpeciesD. rerio (zebrafish), A. thaliana (mustard weed)
-
Insert Size (bp)3998
-
MutationD387A
-
GenBank IDENSDARG00000002230
- Promoter UAS
-
Tag
/ Fusion Protein
- EGFP
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gaccatgattacgccaagct
- 3′ sequencing primer gtaaaacgacggccagtgaa (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHD57 [Tol2-UAS:sypb-egfp-cry2-polyA] was a gift from Alexander Gottschalk (Addgene plasmid # 198381 ; http://n2t.net/addgene:198381 ; RRID:Addgene_198381) -
For your References section:
Rapid and reversible optogenetic silencing of synaptic transmission by clustering of synaptic vesicles. Vettkotter D, Schneider M, Goulden BD, Dill H, Liewald J, Zeiler S, Guldan J, Ates YA, Watanabe S, Gottschalk A. Nat Commun. 2022 Dec 19;13(1):7827. doi: 10.1038/s41467-022-35324-z. 10.1038/s41467-022-35324-z PubMed 36535932