p-mCherry2-sgMUC4
(Plasmid #198399)

• Purpose: Expresses a guide RNA against a repetitive locus found in the MUC4 gene of human chromosome 3, with mCherry2 reporter
• Depositing Lab: Sarah McClelland
• Depositing Organization: Barts and The London School of Medicine and Dentistry, Queen Mary, University of London
  Located in United Kingdom of Great Britain and Northern Ireland
• Publication: Tovini et al EMBO J. 2023 May 15;42(10):e111587. doi: 10.15252/embj.2022111587. Epub 2023 Apr 17.

Backbone

• Vector backbone: pmCherry-sgRNA (empty)
• Backbone manufacturer: Addgene 198330
• Backbone size w/o insert (bp): 5258
• Total vector size (bp): 5133
• Modifications to backbone: Insertion of sgMUC4
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MUC4 sgRNA
• gRNA/shRNA sequence: GGCGTGACCTGTGGATGCTG
• Species: H. sapiens (human)
• Insert Size (bp): 25
• Entrez Gene: MUC4 (a.k.a. ASGP, HSA276359, MUC-4)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (unknown if destroyed)
• 5′ sequencing primer: gcttaccgtaacttgaaagt

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

MUC4 guide sequence used is from Chen et al., 2013 (/doi.org/10.1016/j.cell.2013.12.001), where it is referred to as MUC4-E3. Target sequence: GGCGTGACCTGTGGATGCTG

DNA (Catalog # 198399-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 198399-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.