1
Plasmid 19863: psiCHECK IRF9 3'UTR
  • IRF9 3'UTR

  • IRF9

  • 380

  • H. sapiens (human)

  • NM_006084

  • IRF9 (IRF-9, ISGF3, ISGF3G, p48)

  • psiCHECK-2
    (Search Vector Database)

  • Promega

  • Mammalian Expression

  • 6249

  • XhoI

  • No

  • NotI

  • No

  • GTACATCAAGAGCTTCGTGG List of Sequencing Primers

  • AAGACTCATTTAGATCCTCACAC

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (3)
  • View map

  • Thomas Tuschl

  • MTA

Comments: 

There are small differences between author's sequence and Addgene sequence. Depositor is aware of the changes. These changes in the sequence do not affect the function of the construct.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Molecular characterization of human Argonaute-containing ribonucleoprotein complexes and their bound target mRNAs. Landthaler et al (RNA. 2008 Oct 31. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 19863" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with