1
Plasmid 20014: pGL-p21UTR
  • p21 3'UTR

  • 1300

  • M. musculus (mouse)

  • NM_007669

  • pGL3-Control
    (Search Vector Database)

  • Promega

  • Mammalian Expression, Luciferase

  • 5256

  • XbaI

  • No

  • XbaI

  • No

  • GGAAAACTCGACGCAAGA List of Sequencing Primers

  • CACATTTGTAGAGGTTTTACTTGCT

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • View map

  • Robert Blelloch

  • MTA
    Luciferase Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Embryonic stem cell-specific microRNAs regulate the G1-S transition and promote rapid proliferation. Wang et al (Nat Genet. 2008 Dec . 40(12):1478-83. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 20014" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only