Skip to main content

pAAV-hSyn-con/fon DREADD Gq-mCherry
(Plasmid #200661)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200661 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4600
  • Total vector size (bp) 7544
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, Cre/Lox ; INTRSECT
  • Selectable markers
    Beta-lactamase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Growth temperature 32C actual
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DREADD Gq-mCherry
  • Alt name
    hM3D-mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    3014
  • Promoter hSyn
  • Tag / Fusion Protein
    • mCherry

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer cagccggaccgcaccacgcga
  • 3′ sequencing primer ggaggagaaaatgaaagccatacggg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-con/fon DREADD Gq-mCherry was a gift from Samer Hattar (Addgene plasmid # 200661 ; http://n2t.net/addgene:200661 ; RRID:Addgene_200661)
  • For your References section:

    M4-ipRGCs regulate contrast sensitivity in vision. Daly KM, Li X, Rathore S, Komal R, Beier C, Ostermeyer GP, Leffler J, Alam NM, Prusky GT, Robinson PR, Sivyer B, Grimes WN, Diamond JS, Brown RL, Hattar S. Cell Rep. 2026 Jul 5;45(7):117662. doi: 10.1016/j.celrep.2026.117662. 10.1016/j.celrep.2026.117662 PubMed 42406594