pLV-EF1A-CD19.28H.28TM.28.3z
(Plasmid #200678)

• Purpose: Modular CD28hinge-CD28transmembrane-CD28-CD3z CAR backbone, For Transient Expression or Lentiviral Production
• Depositing Lab: Michele Bernasconi
• Publication: Timpanaro et al J Exp Clin Cancer Res. 2023 Nov 4;42(1):293. doi: 10.1186/s13046-023-02838-3.

Backbone

• Vector backbone: pLV
• Backbone manufacturer: VectorBuilder
• Backbone size w/o insert (bp): 6451
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FMC63-CD28HD-CD28TM-CD28-CD3z-P2A-EGFP
• Alt name: CD19(FMC63)-CAR, CD28 hinge, CD28 transmembrane, CD28 costim., CD3z stim domains, P2A-GFP marker
• Alt name: Contains: FMC63-scFV, CD28 Hinge domain, CD28-transmembrane domain, CD28-ITD, CD3z-ITD
• Species: H. sapiens (human)
• Insert Size (bp): 2334
• Entrez Gene: CD28 (a.k.a. Tp44)
• Entrez Gene: CD247 (a.k.a. CD3-ZETA, CD3H, CD3Q, CD3Z, CD3ZETA, IMD25, T3Z, TCRZ)
• Promoter: EF1a-short
• Tag / Fusion Protein:
  • MycTag (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgatgtcgtgtactggctcc
• 3′ sequencing primer: tttcttccacgtcgcctgcttg

Resource Information

• Supplemental Documents:
  • pLV-EF1A-CD19.28h.28TM.28.3z.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry