pJS288
(Plasmid #200714)

• Purpose: To express yeast Hxt1 hexose transporter in yeast
• Depositing Lab: Jens Boch
• Publication: Fuhrmeister et al Bio Protoc. 2023 Aug 5;13(15):e4733. doi: 10.21769/BioProtoc.4733. eCollection 2023 Aug 5.

Backbone

• Vector backbone: pAGT572
• Backbone manufacturer: Sylvestre Marillonnet; Alain Tissier
• Backbone size w/o insert (bp): 5060
• Total vector size (bp): 8227
• Vector type: Yeast Expression, Synthetic Biology
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: PMA1 promoter
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 1008
• Mutation: domesticated for MoClo cloning (removal of internal BpiI or BsaI sites)
• Entrez Gene: PMA1 (a.k.a. YGL008C, KTI10)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: CCAATCTAAGTCTGTGCTCCTTCC
• 3′ sequencing primer: CTGCCTTTGCTGAGCTGGATC

Gene/Insert 2

• Gene/Insert name: Hxt1
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 1710
• GenBank ID:
• Entrez Gene: HXT1 (a.k.a. YHR094C, HOR4)
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: CCAATCTAAGTCTGTGCTCCTTCC
• 3′ sequencing primer: CTGCCTTTGCTGAGCTGGATC

Gene/Insert 3

• Gene/Insert name: ADH2 Ter
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 327
• GenBank ID: CP020137.1
• Entrez Gene: ADH2 (a.k.a. YMR303C, ADR2)

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: CCAATCTAAGTCTGTGCTCCTTCC
• 3′ sequencing primer: CTGCCTTTGCTGAGCTGGATC

Resource Information

• Supplemental Documents:
  • pJS288.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry