AAV-Syn-DIO-TRPV1-P2A-mCherry
(Plasmid
#200831)
-
PurposeIn the presence of Cre, drives neuron-specific expression of TRPV1 with fluorescence reporter mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200831 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV-hSyn-DIO-hM4D(Gi)-mCherry
- Backbone size w/o insert (bp) 4800
- Total vector size (bp) 8162
-
Modifications to backboneAAV-hSyn-DIO-hM4D(Gi)-mCherry
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTRPV1-P2A-mCherry
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)3250
-
Entrez GeneTrpv1 (a.k.a. TRPV1_SON, VR.5'sv, Vr1, Vr1l1)
- Promoter hSyn
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACTCAGCGCTGCCTCAGTCTG
- 3′ sequencing primer GCAGCGTATCCACATAGCGTA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-Syn-DIO-TRPV1-P2A-mCherry was a gift from Hong Chen (Addgene plasmid # 200831 ; http://n2t.net/addgene:200831 ; RRID:Addgene_200831) -
For your References section:
Sonothermogenetics for noninvasive and cell-type specific deep brain neuromodulation. Yang Y, Pacia CP, Ye D, Zhu L, Baek H, Yue Y, Yuan J, Miller MJ, Cui J, Culver JP, Bruchas MR, Chen H. Brain Stimul. 2021 Jul-Aug;14(4):790-800. doi: 10.1016/j.brs.2021.04.021. Epub 2021 May 11. 10.1016/j.brs.2021.04.021 PubMed 33989819