Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV-Syn-DIO-TRPV1-P2A-mCherry
(Plasmid #200831)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 200831 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV-hSyn-DIO-hM4D(Gi)-mCherry
  • Backbone size w/o insert (bp) 4800
  • Total vector size (bp) 8162
  • Modifications to backbone
    AAV-hSyn-DIO-hM4D(Gi)-mCherry
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TRPV1-P2A-mCherry
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3250
  • Entrez Gene
    Trpv1 (a.k.a. TRPV1_SON, VR.5'sv, Vr1, Vr1l1)
  • Promoter hSyn

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer GCAGCGTATCCACATAGCGTA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-Syn-DIO-TRPV1-P2A-mCherry was a gift from Hong Chen (Addgene plasmid # 200831 ; http://n2t.net/addgene:200831 ; RRID:Addgene_200831)
  • For your References section:

    Sonothermogenetics for noninvasive and cell-type specific deep brain neuromodulation. Yang Y, Pacia CP, Ye D, Zhu L, Baek H, Yue Y, Yuan J, Miller MJ, Cui J, Culver JP, Bruchas MR, Chen H. Brain Stimul. 2021 Jul-Aug;14(4):790-800. doi: 10.1016/j.brs.2021.04.021. Epub 2021 May 11. 10.1016/j.brs.2021.04.021 PubMed 33989819