Mito-TurboID
(Plasmid
#200960)
-
PurposeTransiently expresses mitochondria localized TurboID with V5 tags
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200960 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6500
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemito-TurboID
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1158
- Promoter CMV
-
Tag
/ Fusion Protein
- V5 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer agacccaagcttgggccgccaccatgctggccacccgc
- 3′ sequencing primer gctgggcctggacagcacctaatgaggatcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
“Please visit https://www.biorxiv.org/content/10.1101/2023.01.22.525042v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Mito-TurboID was a gift from Keriann Backus (Addgene plasmid # 200960 ; http://n2t.net/addgene:200960 ; RRID:Addgene_200960) -
For your References section:
Proximity-labeling chemoproteomics defines the subcellular cysteinome and inflammation-responsive mitochondrial redoxome. Yan T, Julio AR, Villanueva M, Jones AE, Ball AB, Boatner LM, Turmon AC, Nguyen KB, Yen SL, Desai HS, Divakaruni AS, Backus KM. Cell Chem Biol. 2023 Jul 20;30(7):811-827.e7. doi: 10.1016/j.chembiol.2023.06.008. Epub 2023 Jul 6. 10.1016/j.chembiol.2023.06.008 PubMed 37419112