Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

M2e-noro-VLP
(Plasmid #201192)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 201192 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pOET5.1
  • Backbone manufacturer
    Oxford Expression Technologies
  • Backbone size w/o insert (bp) 4573
  • Total vector size (bp) 6258
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    M2e-noro-VLP
  • Alt name
    Noro-M2e
  • Species
    H. sapiens (human); Human norovirus, Human influenza virus
  • Insert Size (bp)
    1685
  • GenBank ID
    AFV08795
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • Influenza M2e peptide (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer taagtattttactgttttcgtaacagttttgtaataaaaaaacct
  • 3′ sequencing primer agaatctagcgcttaataaatgtactaataacaatgtatcg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Gene synthesis and subcloning was done as service at Genscript, USA.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    M2e-noro-VLP was a gift from Vesa Hytönen (Addgene plasmid # 201192 ; http://n2t.net/addgene:201192 ; RRID:Addgene_201192)