pEGFP-C1-PH-GAP1IP4BP
(Plasmid
#20200)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 20200 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePH-GAP1IP4BP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)408
-
MutationIsolated PH/Btk domain
-
GenBank IDRASA3
-
Entrez GeneRASA3 (a.k.a. GAP1IP4BP, GAPIII)
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GATCACATGGTCCTGCTGGAG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1-PH-GAP1IP4BP was a gift from Robin Irvine (Addgene plasmid # 20200 ; http://n2t.net/addgene:20200 ; RRID:Addgene_20200) -
For your References section:
Reversible binding and rapid diffusion of proteins in complex with inositol lipids serves to coordinate free movement with spatial information. Hammond GR, Sim Y, Lagnado L, Irvine RF. J Cell Biol. 2009 Jan 19. ():. 10.1083/jcb.200809073 PubMed 19153221