V5-LOV-Turbo1-NIK3x_pTRE-G418
(Plasmid
#202017)
-
Purposeexpresses LOV-Turbo1-NIK3x in the mammalian nucleolus under dox inducible promoter, lentiviral vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202017 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTRE
- Total vector size (bp) 9112
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameV5-LOV-Turbo1-NIK3x
-
SpeciesSynthetic
-
Insert Size (bp)1536
- Promoter pTRE-Tight
-
Tag
/ Fusion Protein
- V5 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcagagctcgtttagtgaaccg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.02.07.527548v1 for bioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
V5-LOV-Turbo1-NIK3x_pTRE-G418 was a gift from Alice Ting (Addgene plasmid # 202017 ; http://n2t.net/addgene:202017 ; RRID:Addgene_202017) -
For your References section:
Dynamic mapping of proteome trafficking within and between living cells by TransitID. Qin W, Cheah JS, Xu C, Messing J, Freibaum BD, Boeynaems S, Taylor JP, Udeshi ND, Carr SA, Ting AY. Cell. 2023 Jun 23:S0092-8674(23)00596-2. doi: 10.1016/j.cell.2023.05.044. 10.1016/j.cell.2023.05.044 PubMed 37385249