LentiCRISPR v2 RB1 sgRNA #1
(Plasmid #202516)

• Purpose: Expressing Cas9 and sgRNA targeting human RB1 gene
• Depositing Lab: Ming Chen
• Publication: Wang et al J Clin Invest. 2023 Mar 16:e166647. doi: 10.1172/JCI166647.

Backbone

• Vector backbone: LentiCRISPR v2
• Backbone size w/o insert (bp): 14871
• Total vector size (bp): 13013
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: RB1 sgRNA
• gRNA/shRNA sequence: AAGTGAACGACATCTCATCT
• Species: H. sapiens (human)
• GenBank ID: NM_000321.3
• Entrez Gene: RB1 (a.k.a. OSRC, PPP1R130, RB, p105-Rb, p110-RB1, pRb, pp110)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: U6

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry