AAV1-DIO-eGFP-pvRPL10a
(Plasmid #202542)

• Purpose: Cr-dependent (DIO) expression of eGFP-tagged ribosomal subunit that uses the prairie vole RPL10a gene sequence under the human synapsin promoter.
• Depositing Lab: Zoe Donaldson
• Publication: Sadino et al Elife. 2023 Feb 28;12:e80517. doi: 10.7554/eLife.80517.

Backbone

• Vector backbone: pAAV-DIO-EGFP
• Backbone size w/o insert (bp): 5522
• Total vector size (bp): 6299
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: RPL10a subunit of the ribosome
• Species: Microtus ochrogaster (Prairie Vole)
• Insert Size (bp): 777
• Mutation: optimized for prairie vole DNA sequence and optimal codon usage
• GenBank ID: XM_005360358.1
• Promoter: human synapsin
• Tag / Fusion Protein:
  • eGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Asc1 (unknown if destroyed)
• 3′ cloning site: BsrG1-HF (not destroyed)
• 5′ sequencing primer: agagttttcgccccgaagaac
• 3′ sequencing primer: catggtcctgctggagttcgtg

Resource Information

• Supplemental Documents:
  • paav-dio-egfppvrpl10a.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry