AAV1-DIO-eGFP-pvRPL10a
(Plasmid
#202542)
-
PurposeCr-dependent (DIO) expression of eGFP-tagged ribosomal subunit that uses the prairie vole RPL10a gene sequence under the human synapsin promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202542 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-DIO-EGFP
- Backbone size w/o insert (bp) 5522
- Total vector size (bp) 6299
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRPL10a subunit of the ribosome
-
SpeciesMicrotus ochrogaster (Prairie Vole)
-
Insert Size (bp)777
-
Mutationoptimized for prairie vole DNA sequence and optimal codon usage
-
GenBank IDXM_005360358.1
- Promoter human synapsin
-
Tag
/ Fusion Protein
- eGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Asc1 (unknown if destroyed)
- 3′ cloning site BsrG1-HF (not destroyed)
- 5′ sequencing primer agagttttcgccccgaagaac
- 3′ sequencing primer catggtcctgctggagttcgtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV1-DIO-eGFP-pvRPL10a was a gift from Zoe Donaldson (Addgene plasmid # 202542 ; http://n2t.net/addgene:202542 ; RRID:Addgene_202542) -
For your References section:
Prolonged partner separation erodes nucleus accumbens transcriptional signatures of pair bonding in male prairie voles. Sadino JM, Bradeen XG, Kelly CJ, Brusman LE, Walker DM, Donaldson ZR. Elife. 2023 Feb 28;12:e80517. doi: 10.7554/eLife.80517. 10.7554/eLife.80517 PubMed 36852906