mNeonGreen-APEX3
(Plasmid
#202590)
-
PurposeGamma-retroviral vector that expresses mNeonGreen fused to APEX3.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202590 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMIGR1-derivative
- Backbone size w/o insert (bp) 6142
- Total vector size (bp) 7647
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemNeonGreen-APEX3-V5
-
Alt nameAPEX2-L242A
-
Insert Size (bp)1566
-
MutationAPEX2 L242A
-
GenBank IDNM_001250856.1 KC295282.1
-
Entrez GeneAPX1 (a.k.a. GLYMA_11G150243v4)
- Promoter MESV LTR
-
Tags
/ Fusion Proteins
- mNeonGreen (N terminal on insert)
- V5 epitope (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer gggagaggggcgctagtcagtta (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mNeonGreen-APEX3 was a gift from Reuben Harris (Addgene plasmid # 202590 ; http://n2t.net/addgene:202590 ; RRID:Addgene_202590) -
For your References section:
APEX3 - an optimized tool for rapid and unbiased proximity labeling. Becker JT, Auerbach AA, Harris RS. J Mol Biol. 2023 May 12:168145. doi: 10.1016/j.jmb.2023.168145. 10.1016/j.jmb.2023.168145 PubMed 37182813