Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mNeonGreen-APEX3
(Plasmid #202590)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 202590 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MIGR1-derivative
  • Backbone size w/o insert (bp) 6142
  • Total vector size (bp) 7647
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mNeonGreen-APEX3-V5
  • Alt name
    APEX2-L242A
  • Insert Size (bp)
    1566
  • Mutation
    APEX2 L242A
  • GenBank ID
    NM_001250856.1 KC295282.1
  • Entrez Gene
    APX1 (a.k.a. GLYMA_11G150243v4)
  • Promoter MESV LTR
  • Tags / Fusion Proteins
    • mNeonGreen (N terminal on insert)
    • V5 epitope (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer gggagaggggcgctagtcagtta
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mNeonGreen-APEX3 was a gift from Reuben Harris (Addgene plasmid # 202590 ; http://n2t.net/addgene:202590 ; RRID:Addgene_202590)
  • For your References section:

    APEX3 - an optimized tool for rapid and unbiased proximity labeling. Becker JT, Auerbach AA, Harris RS. J Mol Biol. 2023 May 12:168145. doi: 10.1016/j.jmb.2023.168145. 10.1016/j.jmb.2023.168145 PubMed 37182813