1
Plasmid Cart
Login to add to cart
Recently Visited
Plasmid 20346: pStart-K
  • pStart-K

  • cloning vector

  • EU530620

  • pACYC177
    (Search Vector Database)

  • Mouse Targeting

  • Gateway cloning

  • Gateway Cloning

  • TAAACTGCCAGGCATCAAACTAAGC List of Sequencing Primers

  • AGTCAGCCCCATACGATATAAGTTG

  • Kanamycin

  • DH5alpha

  • 37

  • DB3.1

  • Low Copy

  • View sequences (2)
  • View map

  • Mario Capecchi

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A protocol for constructing gene targeting vectors: generating knockout mice for the cadherin family and beyond. Wu et al (Nat Protoc. 2008 . 3(6):1056-76. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 20346" in your Materials and Methods section.