pAG416GAL10-SHV_3CL
(Plasmid
#203473)
-
PurposeExpresses SHV 3CL protease from a GAL10 promoter with a URA3 marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 203473 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAG416GAL10-ccdB-6stop
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSHV 3CL protease
-
Alt nameSouthampton Virus 3CL protease
- Promoter GAL10
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer tggggctctttacatttcca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG416GAL10-SHV_3CL was a gift from Alejandro Chavez (Addgene plasmid # 203473 ; http://n2t.net/addgene:203473 ; RRID:Addgene_203473)