Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMRMTK-clo14
(Plasmid #203984)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 203984 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    R6Kγ origin of replication, oriT & chloramphenicol resistance gene
  • Backbone size w/o insert (bp) 1607
  • Total vector size (bp) 1752
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Elu ES1
  • Insert Size (bp)
    145
  • Promoter Elu ES1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (not destroyed)
  • 3′ cloning site BsaI (not destroyed)
  • 5′ sequencing primer gtaacgcactgagaagcccttagag
  • 3′ sequencing primer CCTGCCACTCATCGCAGTACTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMRMTK-clo14 was a gift from Nathan Crook (Addgene plasmid # 203984 ; http://n2t.net/addgene:203984 ; RRID:Addgene_203984)
  • For your References section:

    Engineering the Maize Root Microbiome: A Rapid MoClo Toolkit and Identification of Potential Bacterial Chassis for Studying Plant-Microbe Interactions. van Schaik J, Li Z, Cheadle J, Crook N. ACS Synth Biol. 2023 Oct 20;12(10):3030-3040. doi: 10.1021/acssynbio.3c00371. Epub 2023 Sep 15. 10.1021/acssynbio.3c00371 PubMed 37712562