pLenti-tetON-NKX2-1-I207F -EF1a-TagRFP-2A-tet3G
(Plasmid #204212)

• Purpose: Doxycycline inducible lentiviral vector for human NKX2-1 (I207F) overexpression
• Depositing Lab: Emma Rawlins
• Publication: Lim et al Cell Stem Cell. 2023 Jan 5;30(1):20-37.e9. doi: 10.1016/j.stem.2022.11.013. Epub 2022 Dec 8.

Backbone

• Vector backbone: pHAGE
• Backbone size w/o insert (bp): 8676
• Total vector size (bp): 9792
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NK2 homeobox 1
• Alt name: TTF1
• Species: H. sapiens (human)
• Insert Size (bp): 1116
• GenBank ID: NM_001079668
• Entrez Gene: NKX2-1 (a.k.a. BCH, BHC, NK-2, NKX2.1, NKX2A, NMTC1, T/EBP, TEBP, TITF1, TTF-1, TTF1)
• Promoter: TetON
• Tag / Fusion Protein:
  • Point mutation on I207F

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: ATGTCGATGAGTCCAAAGCACACG
• 3′ sequencing primer: TCACCAGGTCCGACCGTATAGC

Resource Information

• Supplemental Documents:
  • pLenti-tetON-NKX2-1-I207F -EF1a-TagRFP-2A-tet3G.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry