pTRIP-hPGK-Blast-2A-STING-TurboID
(Plasmid
#204713)
-
PurposeExpresses C-terminal TurboID tagged human STING for proximity ligation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204713 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTRIP
- Backbone size w/o insert (bp) 9119
- Total vector size (bp) 12237
-
Modifications to backboneAdded hPGK promoter, blast resistance gene, 2A peptide
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSTING1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1137
-
Entrez GeneSTING1 (a.k.a. ERIS, MITA, MPYS, NET23, SAVI, STING, STING-beta, TMEM173, hMITA, hSTING)
- Promoter hPGK
-
Tag
/ Fusion Protein
- TurboID (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgagaacaggggcatcttga
- 3′ sequencing primer ctaagatctacagctgccttgt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRIP-hPGK-Blast-2A-STING-TurboID was a gift from Nir Hacohen (Addgene plasmid # 204713 ; http://n2t.net/addgene:204713 ; RRID:Addgene_204713) -
For your References section:
ESCRT-dependent STING degradation inhibits steady-state and cGAMP-induced signalling. Gentili M, Liu B, Papanastasiou M, Dele-Oni D, Schwartz MA, Carlson RJ, Al'Khafaji AM, Krug K, Brown A, Doench JG, Carr SA, Hacohen N. Nat Commun. 2023 Feb 4;14(1):611. doi: 10.1038/s41467-023-36132-9. 10.1038/s41467-023-36132-9 PubMed 36739287