pTRIP-hPGK-Blast-2A-STING-TurboID
(Plasmid #204713)

• Purpose: Expresses C-terminal TurboID tagged human STING for proximity ligation.
• Depositing Lab: Nir Hacohen
• Publication: Gentili et al Nat Commun. 2023 Feb 4;14(1):611. doi: 10.1038/s41467-023-36132-9.

Backbone

• Vector backbone: pTRIP
• Backbone size w/o insert (bp): 9119
• Total vector size (bp): 12237
• Modifications to backbone: Added hPGK promoter, blast resistance gene, 2A peptide
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: STING1
• Species: H. sapiens (human)
• Insert Size (bp): 1137
• Entrez Gene: STING1 (a.k.a. ERIS, MITA, MPYS, NET23, SAVI, STING, STING-beta, TMEM173, hMITA, hSTING)
• Promoter: hPGK
• Tag / Fusion Protein:
  • TurboID (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgagaacaggggcatcttga
• 3′ sequencing primer: ctaagatctacagctgccttgt

Resource Information

• Supplemental Documents:
  • pTRIP-hPGK-Blast-2A-STING-TurboID.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry