pR008_APAD
(Plasmid #204818)

• Purpose: Expression Apobec1-ADAR2dd fusion protein as PIE-RBP control
• Depositing Lab: Xiaochang Zhang
• Publication: Ruan et al Nat Commun. 2023 Jun 6;14(1):3275. doi: 10.1038/s41467-023-39054-8.

Backbone

• Vector backbone: pCAGIG
• Backbone manufacturer: Connie Cepko Lab
• Backbone size w/o insert (bp): 6124
• Total vector size (bp): 8076
• Vector type: Mammalian Expression
• Selectable markers: EGFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rat Apobec1 and human ADAR2 deaminase domain with engineered sites
• Alt name: Apobec1
• Species: R. norvegicus (rat)
• Insert Size (bp): 1950
• GenBank ID: NM_012907
• Entrez Gene: Apobec1 (a.k.a. REPR, apobec-1)
• Promoter: chicken β-actin promoter
• Tags / Fusion Proteins:
  • HA and Flag (N terminal on insert)
  • huADAR2dd (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCTAACCATGTTCATGCCTTC
• 3′ sequencing primer: GGGGGCGGAATTTACGTAGC

Resource Information

• Supplemental Documents:
  • pR008_APAD.gb
• A portion of this plasmid was derived from a plasmid made by: rApobec1-XTEN was amplified from pCMV-BE3 (Addgene #73021), and hADAR2dd was amplified from pC0055 (Addgene #103871) .

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry