pR023_PIE-PUM2
(Plasmid #204819)

• Purpose: Expression PIE-PUM2 fusion protein in mammalian cells
• Depositing Lab: Xiaochang Zhang
• Publication: Ruan et al Nat Commun. 2023 Jun 6;14(1):3275. doi: 10.1038/s41467-023-39054-8.

Backbone

• Vector backbone: pCAGIG
• Backbone manufacturer: Connie Cepko Lab
• Backbone size w/o insert (bp): 6124
• Total vector size (bp): 11305
• Vector type: Mammalian Expression
• Selectable markers: EGFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Pumilio 2
• Alt name: PUM2
• Species: H. sapiens (human)
• GenBank ID: NM_015317
• Entrez Gene: PUM2
• Promoter: chicken β-actin promoter
• Tags / Fusion Proteins:
  • HA-Flag-rApobec1 (N terminal on insert)
  • huADAR2dd (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCTAACCATGTTCATGCCTTC
• 3′ sequencing primer: GGGGGCGGAATTTACGTAGC

Resource Information

• Supplemental Documents:
  • pR023_PIE-PUM2.gb
• A portion of this plasmid was derived from a plasmid made by: rApobec1-XTEN was amplified from pCMV-BE3 (Addgene #73021), hADAR2dd was amplified from pC0055 (Addgene #103871), and PUM2 CDS was amplified from pFRT/FLAG/HA-DEST PUM2 (Addgene #40292).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry