Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTY152 EGFP-T2A-ORF6 SARS-CoV-1
(Plasmid #204974)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 204974 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Currently unavailable outside the U.S.

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSectag2
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 5885
  • Modifications to backbone
    EGFP-T2A inserted at the N-terminus of ORF6
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Open Reading Frame 6
  • Species
    SARS-CoV-1
  • Insert Size (bp)
    192
  • Entrez Gene
    ORF6 (a.k.a. sars6)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTY152 EGFP-T2A-ORF6 SARS-CoV-1 was a gift from Tim Mitchison (Addgene plasmid # 204974 ; http://n2t.net/addgene:204974 ; RRID:Addgene_204974)
  • For your References section:

    Quantitative comparison of nuclear transport inhibition by SARS coronavirus ORF6 reveals the importance of oligomerization. Yoo TY, Mitchison TJ. Proc Natl Acad Sci U S A. 2024 Jan 23;121(4):e2307997121. doi: 10.1073/pnas.2307997121. Epub 2024 Jan 18. 10.1073/pnas.2307997121 PubMed 38236733