pcDNA-tdMCP-12xGCN4
(Plasmid
#205158)
-
Purposeexpress tdMCP-12xGCN4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205158 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA
- Total vector size (bp) 6986
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametdMCP-12xGCN4
-
SpeciesSynthetic
-
Insert Size (bp)1618
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bytdMCP is amplified from Addene plasmid #64541 and the suntag arrays is amplified from Addene plasmid #74928
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA-tdMCP-12xGCN4 was a gift from Weirui Ma (Addgene plasmid # 205158 ; http://n2t.net/addgene:205158 ; RRID:Addgene_205158) -
For your References section:
Enhanced single RNA imaging reveals dynamic gene expression in live animals. Hu Y, Xu J, Gao E, Fan X, Wei J, Ye B, Xu S, Ma W. Elife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. 10.7554/eLife.82178 PubMed 36867026