pAG1160 mCherry-FIREtag
(Plasmid
#205164)
-
PurposeExpresses mCherry -FIREtag in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205164 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepIRES
- Backbone size w/o insert (bp) 4005
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-FIREtag
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG1160 mCherry-FIREtag was a gift from Arnaud Gautier (Addgene plasmid # 205164 ; http://n2t.net/addgene:205164 ; RRID:Addgene_205164) -
For your References section:
A fluorogenic chemically induced dimerization technology for controlling, imaging and sensing protein proximity. Bottone S, Joliot O, Cakil ZV, El Hajji L, Rakotoarison LM, Boncompain G, Perez F, Gautier A. Nat Methods. 2023 Aug 28. doi: 10.1038/s41592-023-01988-8. 10.1038/s41592-023-01988-8 PubMed 37640938