Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Cav2.2 HA EIA (E314A) pCAGGS
(Plasmid #206081)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 206081 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAGGS
  • Backbone manufacturer
    PMID 11397804
  • Backbone size w/o insert (bp) 4890
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cacna1b
  • Alt name
    Cav2.2 alpha1B
  • Species
    O. cuniculus (rabbit)
  • Insert Size (bp)
    7160
  • Mutation
    E314A
  • Entrez Gene
    CACNA1B
  • Promoter CMV/B-actin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CTCTGCTAACCATGTTCATGC
  • 3′ sequencing primer CTGATAGGCAGCCTGCACCTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Yasuo Mori

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' end of Cav2.2 DNA is very GC rich

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cav2.2 HA EIA (E314A) pCAGGS was a gift from Annette Dolphin (Addgene plasmid # 206081 ; http://n2t.net/addgene:206081 ; RRID:Addgene_206081)
  • For your References section:

    Disruption of the Key Ca(2+) Binding Site in the Selectivity Filter of Neuronal Voltage-Gated Calcium Channels Inhibits Channel Trafficking. Meyer JO, Dahimene S, Page KM, Ferron L, Kadurin I, Ellaway JIJ, Zhao P, Patel T, Rothwell SW, Lin P, Pratt WS, Dolphin AC. Cell Rep. 2019 Oct 1;29(1):22-33.e5. doi: 10.1016/j.celrep.2019.08.079. 10.1016/j.celrep.2019.08.079 PubMed 31577951