cacna2d1 R241A pMT2
(Plasmid #206110)

• Purpose: expression of rat alpha2delta-1 calcium channel auxillary subunit and with R421A mutation that disrupts Gabapentin binding
• Depositing Lab: Annette Dolphin
• Publication: Cassidy et al Proc Natl Acad Sci U S A. 2014 Jun 17;111(24):8979-84. doi: 10.1073/pnas.1403731111. Epub 2014 Jun 2.

Backbone

• Vector backbone: pMT2
• Backbone manufacturer: Genetics Institute Inc
• Backbone size w/o insert (bp): 5163
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: cacna2d1
• Alt name: alpha2delta-1
• Species: R. norvegicus (rat)
• Mutation: R241A
• Entrez Gene: Cacna2d1 (a.k.a. CCHLA2, Cacna2, DHSCCA)
• Promoter: Ad MLP/TPL/SV40

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: AGCTTGAGGTGTGGCAGGCTT
• 3′ sequencing primer: GGTCGAACCATGATGGCAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Kevin Campbell

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry